Default format. In this format, the sequence is given first. Then, the structure is given, with matching parentheses ( and ) denoting a base pair, and a dot denoting an unpaired base.
Example :
The bpseq format is a simple text format in which there is one line per base in the molecule, listing the the position of the base (leftmost position is 1), the base name (A,C,G,U, or other alphabetical characters), and the position number of the base to which it is paired, with a 0 denoting that the base is unpaired.
For example, the structure represented in dot-parentheses format above would be represented in bpseq format as follows :
N.B.: "Filename", "Organism", "Accession Number" and "Citation and related information available at ?" fields are required.
The first line contains the sequence length L (which can be followed by the name of the molecule). There are L subsequent lines, one per nucleotide. The ith line starts with i, then the letter denoting the ith nucleotide, then the 5'-connecting base index (i-1), then the 3' connecting base index (i+1), then the paired base index (or 0 if unpaired), and finally base index in the original sequence.
For example, the structure represented in bpseq format above would be represented in ct format as follows :
It's possible to load two different formats for one comparison.
Algnment mode options :
NestedAlign has a default "light" score matrix.
But it's possible to choose two other score matrix types :
Open from a dot-bracket manual input via 'Open->User input' or 'M' shortcut. Inputs could also be done from a DBN, BPSEQ or CT file with 'Open->file'.
| Shortcut | Description | Available with modification off |
|---|---|---|
| Redraw with radiate algorithm | ||
| Redraw with circular algorithm | ||
| Redraw with NAView algorithm | ||
| Color dash bases (-) | ||
| Full screen view | ||
| Manual input | ||
| Open file | ||
| Print the RNA | ||
| Reset the view | ||
| Color special bases (non A,C,G,U,-) | ||
| Set title |
| Param name | Value format/type | Description | Since version |
|---|---|---|---|
algorithm | Sets the layout algorithm to be used for initial placement. As of version 1.0, valid values for this options are radiate (Tree-like structure) and circular (Circular Feynman's diagrams) | ||
applyBasesStyle | See basesStyle description | ||
backbone | Sets the color used to draw the bonds involved in the backbone | ||
background | Sets the background color | ||
baseInner | Sets the color used to fill the disc on top of which the nucleotide is drawn | ||
baseName | Sets the color used to draw the nucleotide name | ||
baseNum | Sets the color used to draw the nucleotide number | ||
baseOutline | Sets the color used to draw the outer circle around the nucleotide | ||
basesStyle | See applyBasesStyle description | ||
bp | Sets the color used to draw the base-pairings (hydrogen bonds) | ||
columns | Sets the number of columns in a multipanel layout | ||
comparisonMode | Sets the applet in comparison mode if true. false by default | ||
error | Shows varna errors if true. true by default. | ||
modifiable | allow the user to modify the arn display if true. true by default. | ||
periodNum | Sets the numbering period. Nucleotide numbers will be printed for each base whose position is a multiple of the period n. First nucleotide number is always displayed to provide a frame of reference. | ||
rows | Sets the number of rows in a multipanel layout | ||
sequenceDBN | Sets the raw nucleotide sequence for the displayed RNA. Each base must be encoded in a single character. Letters additional to [A,C,G,U] are tolerated | ||
structureDBN | Sets the secondary structure of the displayed RNA in Dot-Bracket Notation (DBN). Valid structures in DBN format are well-parenthesized words consisting of dots '.', opening '(' and closing ')' parentheses. Dotted positions will be unpaired, whereas matching parenthesized positions will represent base-pairing nucleotides. | ||
title | Sets the title of the displayed RNA. If set to the empty string "", does not display any title, leaving some extra room for the drawings | ||
titleColor | Sets the color used to display the title | ||
titleSize | Sets the font size used to display the title | ||
warning | Shows varna warnings if true. false by default. | ||
zoom | Sets the zoom in used | ||
zoomAmount | Sets the zoom amount in used |
basesStyle creates a new style for bases, it defines the outline, the innerline, the name and the associate number color via these parameters:
basesOutlineColor, basesInnerColor, basesNameColor, basesNumbersColor.
Examples:
1 |
<param name="basesStyle0" value="basesOutlineColor=#000000, basesInnerColor=#0000FF, basesNameColor=#00FF00, basesNumbersColor=#FF0000"/> |
2 |
<param name="basesStyle1" value="basesInnerColor=#0000FF, basesNumbersColor=#FF0000"/> |
3 |
<param name="basesStyle3" value="basesOutlineColor=#00FF00"/> |
applyBasesStyle applies an existing bases style on a list of bases (in only one panel in multiple panels case).
The parameter name means: applyBasesStyle[int: basesStyle number]on[int: panel number]
Examples:
1 |
<param name="applyBasesStyle0on1" value="22, 23, 24, 114, 115, 116" /> |
2 |
<param name="applyBasesStyle1on1" value="27, 28, 29, 30, 67, 68, 69, 70"/> |
3 |
<param name="applyBasesStyle0on2" value="10, 11, 12, 46, 47, 48"/> |
4 |
<param name="applyBasesStyle3on3" value="54, 55, 56, 97, 98, 99"/> |
1 |
<applet code="applis.VARNA" |
2 |
codebase="/varna" |
3 |
archive="VARNA31.jar" |
4 |
width="90%" height="600"> |
5 |
<param name="rows" value="1" /> |
6 |
<param name="columns" value="2" /> |
7 |
<param name="sequenceDBN1" value="CCAGACGUUCUUCGCCGAGAGUCGUCGGGGUUUCCUGCUUCAACAGUGCUUGGAC |
8 |
GGAACCCGGCGCUCGUUCCCCACCCCGGCCGGCCGCCCAUAGCCAGCCCUCCGUCACCUC |
9 |
UUCACCGCACCCUCGGACUGCCCCAAGGCCCCCGCCGCCGCUCCAGCGCCGCGCAGCCAC |
10 |
CGCCGCCGCCGCCGCCUCUCCUUAGUCGCCGCC"/> |
11 |
<param name="structureDBN1" value="...(((............(((.(((((((..((((.(.(((((......)))))))))))))))))))) |
12 |
...........((((((((.((.........((..((((....................))))..)).....(((...(((.((.((.. |
13 |
..)))).)))..)))...)).))))..))))..........)))......"/> |
14 |
<param name="title1" value="1 human ferritin 5'" /> |
15 |
<param name="warning1" value="true" /> |
16 |
<param name="background1" value="#FFFFEE" /> |
17 |
<param name="modifiable1" value="false" /> |
18 |
<param name="sequenceDBN2" value="CAGACGUUCUCGCCCAGAGUCGCCGCGGUUUCCUGCUUCAACAGUGCUUGAACGG |
19 |
AACCCGGUGCUCGACCCCUCCGACCCCCGCCGGCCGCUUCGAGCCUGAGCCCUUUGCAAC |
20 |
UUCGUCGUUCCGCCGCUCCAGCGUCGCCACCGCGCCUCGCCCCGCCGCCACC"/> |
21 |
<param name="structureDBN2" value="..((((........(((((..((((.((((.((.(.(((((......))))))))))))))))((((((.....(((........))).....)))))).. |
22 |
.....)))))......)))).....((.((....(((..((......))..)))...)).))...."/> |
23 |
<param name="title2" value="2 mouse ferritin 5'" /> |
24 |
<param name="warning2" value="false" /> |
25 |
<param name="background2" value="#FFEEFF" /> |
26 |
<param name="modifiable2" value="true" /> |
27 |
<param name="basesStyle0" value="basesInnerColor=#0000FF" /> |
28 |
<param name="basesStyle1" value="basesInnerColor=#FF9966" /> |
29 |
<param name="basesStyle2" value="basesInnerColor=#00CCFF" /> |
30 |
<param name="basesStyle7" value="basesInnerColor=#FF3399" /> |
31 |
<param name="basesStyle11" value="basesInnerColor=#00FF99" /> |
32 |
<param name="applyBasesStyle0on2" value="22, 23, 24, 114, 115, 116" /> |
33 |
<param name="applyBasesStyle1on2" value="27, 28, 29, 30, 67, 68, 69, 70" /> |
34 |
<param name="applyBasesStyle2on1" value="43, 44, 45, 46, 47, 48, 49, 50" /> |
35 |
<param name="applyBasesStyle11on1" value="36, 37, 63, 64" /> |
36 |
<param name="applyBasesStyle7on2" value="39, 40, 61, 62" /> |
37 |
<param name="applyBasesStyle0on2" value="149, 150, 151" /> |
38 |
</applet> |